Can I sequence a peptide that is acetylated or biotinylated?

Product FAQ

Answer

No. These groups effectively block the N terminus.

Answer Id: E1267

Was this answer helpful?

Yes
No
9938e76f3b572f7bc6c61808f1015d8a_FAQ

Where is the transcriptional start site of the T7 promoter featured in many of Invitrogen™'s vectors?

Product FAQ

Answer

Although Invitrogen™ has not formally mapped the transcriptional start site of the T7 promoter, the following reference indicates that the start site occurs at the G following the CACTATA sequence found in the promoter: Nucleic Acids Research, Vol.20, No. 20, pp 4626-4634.

Answer Id: E4435

Was this answer helpful?

Yes
No
dc73c49ce03192d2f93e6d0a7e333e45_FAQ

How does adding Platinum® Taq DNA Polymerase improve SuperScript® One-Step RT-PCR performance?

Product FAQ

Answer

Platinum® Taq DNA Polymerase is precomplexed with a mixture of antibodies that inhibit polymerase activity until the initial denaturation step in PCR. As a result, nonspecific polymerase acitivty at lower temperatures during set-up and reverse transcription is eliminated, which provides greater yield and specificity of intended product.

Answer Id: E3214

Was this answer helpful?

Yes
No
70d0c4342fd7cebe3ef559a6c6160df3_FAQ

What is the smallest quantity of RNA detectable by the SuperScript® First-Strand System for RT-PCR?

Product FAQ

Answer

Detection limits dependend on many factors, including primer design, target size, and the abundance of message. In our hands, this system was able to detect GAPDH mRNA from as little as 1.0 pg of total HeLa RNA when used in conjunction with Platinum® Taq DNA Polymerase High Fidelity.

Answer Id: E3215

Was this answer helpful?

Yes
No
215f30d9ddce30cef02c9a0a2f45bad2_FAQ

Must PCR conditions be changed once the original PCR primers have attB sequence added to them?

Product FAQ

Answer

Since the attB sequences are on the 5' end of oligos, they will not anneal to the target template in the first round of PCR. Sometimes the PCR product is more specific with the attB primers, probably due to the longer annealing sequence (all of attB plus gene specific sequence) after the first round of amplification. Generally there is no need to change PCR reaction conditions when primers have the additional attB sequence

Answer Id: E3222

Was this answer helpful?

Yes
No
6b00bdaf7a00bf0e99ab5f0665541997_FAQ

What is the influence of the attB sequence on protein function, solubility, folding, and expression?

Product FAQ

Answer

Destination vectors that contain N-terminal fusion partners will express proteins that contain amino acids contributed from the attB1 site, which is 25 bases long. This means that in addition to any tag (6x His and/or antibody epitope tag) the N-terminus of an expressed protein will contain an additional 9 amino acids from the AttB1 sequence - the typical amino acid sequence is Thr-Ser-Leu-Tyr-Lys-Lys-Ala-Gly-nnn, where nnn will depend on the codon sequence of the insert.

Effects on protein function: A researcher (Simpson et al. EMBO Reports 11(31):287-292, 2000) demonstrated that GFP fusions (N- terminal and C-terminal) localized to the proper intracellular compartment. The expression constructs were generated using Gateway® cloning, so the recombinant protein contained the attB1 or attB2 amino acid sequence. The localization function of the cloned recombinant proteins was preserved.

Effects on expression: We have seen no effect of the attB sites on expression levels in E. coli, insect and mammalian cells. The gus gene was cloned into bacterial expression vectors (for native and N-terminal fusion protein expression) using standard cloning techniques and expressed in bacteria. Gus was also cloned into Gateway® Destination vectors (for native and N-terminal fusion expression) and expressed. When protein expression is compared, there was no difference in the amount of protein produced. This demonstrates that for this particular case the attB sites do not interfere with transcription or translation.

Effects on solubility: A researcher at the NCI has shown that Maltose Binding Protein fusions constructed with Gateway® Cloning were soluble. The fusion proteins expressed had the attB amino acid sequence between the Maltose Binding Protein and the cloned protein. It is possible that some proteins containing the attB sequence could remain insoluble when expressed in E.coli.

Effects on folding: Two Hybrids screens show the same interacters identified with and without the attB sequence. Presumably correct protein folding would be required for protein-protein interactions to take place. It is possible that some proteins containing the attB sequence may not fold correctly.

Answer Id: E3223

Was this answer helpful?

Yes
No
ab8191a69d0225df794d7868ff88a478_FAQ

How large can PCR fragments be and still be cloned into a Gateway® Entry vector?

Product FAQ

Answer

There is no size restriction on the PCR fragments if they are cloned into a pDONR vector. The upper limit for efficient cloning into a TOPO® adapted Gateway® Entry vector is approximately 5 kb. A Gateway® recombination reaction can occur between DNA fragments that are as large as 150 kb.

Answer Id: E3224

Was this answer helpful?

Yes
No
6a32ef26c139750349ac439d4e2b5649_FAQ

What do attL1 and attL2 sites look like after recombination between attB and attP sites?

Product FAQ

Answer

The attP1 sequence (pDONR™) is:
AATAATGATT TTATTTTGAC TGATAGTGAC CTGTTCGTTG CAACAAATTG ATGAGCAATGCTTTTTTAT AATGCCAACT TTGTACAAAA AAGC[TGAACG AGAAACGTAA AATGATATAA ATATCAATAT ATTAAATTAG ATTTTGCATA AAAAACAGACTA CATAATACTG TAAAACACAA CATATCCAGT CACTATGAAT CAACTACTTA GATGGTATTA GTGACCTGTA]

The region within brackets is where the site is "cut" and replaced by the attB1-fragment sequence to make an attL1 site. The sequence GTACAAA is the overlap sequence present in all att1 sites and is always "cut" right before the first G.

The overlap sequence in attP2 sites is CTTGTAC and cut before C. This is attP2:
ACAGGTCACT AATACCATCT AAGTAGTTGA TTCATAGTGA CTGGATATGT TGTGTTTTAC AGTATTATGT AGTCTGTTTT TTATGCAAAA TCTAATTTAA TATATTGATA TTTATATCAT TTTACGTTTC TCGTTCAGCT TTCTTGTACA AAGTTGGCAT TATAAGAAAG CATTGCTTAT AATTTGTTG CAACGAACAG GTCACTATCA GTCAAAATAA AATCATTATT

So, attL1 (Entry Clone) should be:
A ATAATGATTT TATTTTGACT GATAGTGACC TGTTCGTTGC AACAAATTGA TGAGCAATGC TTTTTTATAA TGCCAACT TT G TAC AAA AAA GC[A GGC T]NN NNN

attL2 (Entry Clone) should be:
NNN N[AC C]CA GCT TT CTTGTACA AAGTTGGCAT TATAAGAAAG CATTGCTTAT CAATTTGTTG CAACGAACAG GTCACTATCA GTCAAAATAA AATCATTATT

The sequence in brackets comes from attB, and N is your gene-specific sequence.

Note: When creating an Entry Clone through the BP reaction and a PCR product, the vector backbone is not the same as Gateway® Entry vectors. The backbone in the case of PCR BP cloning is pDONR™201.

Answer Id: E3225

Was this answer helpful?

Yes
No
c3246d8f8b1ce5759a073820536ba7a9_FAQ

Do you have recommended sequencing primers for pDONR™201?

Product FAQ

Answer

We do not offer pre-made primers, but we can recommend the following sequences that can be orders as custom primers for sequencing of pDONR™201:
Forward primer, proximal to attL1: 5'- TCGCGTTAACGCTAGCATGGATCTC
Reverse primer, proximal to attL2: 5'-GTAACATCAGAGATTTTGAGACAC

Answer Id: E3236

Was this answer helpful?

Yes
No
d07bccd23f3a9128e2931d3118ae5a01_FAQ

Do I have to synthesize new attB primers (29 base attB primer + my specific sequence primer) each time I want to make an attB PCR product, or do you have truncated attB primers that work together with adapter attB primers to get a complete attB sequence?

Product FAQ

Answer

We do have an alternative method called the "attB Adapter PCR" Protocol in which you make your gene specific primer with only 12 additional attB bases and use attB universal adapter primers. This protocol allows for shorter primers to amplify attB-PCR products by utilizing four primers instead of the usual two in a PCR reaction. You can find the sequence of these primers in the protocol on page 45 of the "Gateway® Technology with Clonase II" manual.

There is a protocol in which all 4 primers mentioned above are in a single PCR reaction. You can find this protocol at in the following article: Quest vol. 1, Issue 2, 2004. The best ratio of the first gene-specific and the second attB primers was 1:10.

Answer Id: E3237

Was this answer helpful?

Yes
No
40e4ddf8a2fbd57df2589bc11f06e9e2_FAQ

What is the size of the CAT protein when expressed in bacteria?

Product FAQ

Answer

Excluding any amino acids resulting from fusion tags, CAT has an apparent molecular weight of 28-32 kD on SDS-PAGE gels.

Answer Id: E3242

Was this answer helpful?

Yes
No
2181fd7ddcd8781522cb2d232c328b0c_FAQ

Will the Anti-HisG antibody recognize proteins made in pDEST17 (N-terminal His tag vector)?

Product FAQ

Answer

No, the Anti-HisG antibody detects the N-terminal polyhistidine (6x His) tag followed by glycine: HHHHHHG. The proteins made from the pDEST17 vectors do not have this glycine following the His tag and therefore will not be recognized by this antibody.

Answer Id: E3881

Was this answer helpful?

Yes
No
a1277d54e5eaa6a48647f9dbe9146ace_FAQ

Do the Gateway vectors pDEST14, pDEST15, pDEST17, and pDEST24 contain transcription terminators?

Product FAQ

Answer

Yes, all T7 DEST Vectors carry T7 transcription termination sequences downstream of the attR2 site.

Answer Id: E3900

Was this answer helpful?

Yes
No
6ea01f4e47a3eacb5e5e72f2d9c0c4b9_FAQ

What primer purity should be used for adding attB sites to my PCR product?

Product FAQ

Answer

Standard desalted purity is generally sufficient for creating attB primers. We examined HPLC-purified oligos for Gateway® cloning (about 50bp long) and found only about a 2-fold increase in colony number over standard desalted primers. If too few colonies are obtained, you may try to increase the amount of PCR product used and/or incubate the BP reaction overnight.

Answer Id: E3172

Was this answer helpful?

Yes
No
fc138a83fd2868b7715e394b57dbb0f5_FAQ

What is the smallest fragment that can be used in a Gateway® reaction?

Product FAQ

Answer

The smallest size we have recombined is a 70 bp piece of DNA located between the att sites. Very small pieces are difficult to clone since they negatively influence the topology of the recombination reaction.

Answer Id: E3198

Was this answer helpful?

Yes
No
f8a0862ae4d4cb5227ebf626536c1543_FAQ