What is the smallest quantity of RNA detectable by the SuperScript® First-Strand System for RT-PCR?

Product FAQ


Detection limits dependend on many factors, including primer design, target size, and the abundance of message. In our hands, this system was able to detect GAPDH mRNA from as little as 1.0 pg of total HeLa RNA when used in conjunction with Platinum® Taq DNA Polymerase High Fidelity.

Answer Id: E3215

Was this answer helpful?


Must PCR conditions be changed once the original PCR primers have attB sequence added to them?

Product FAQ


Since the attB sequences are on the 5' end of oligos, they will not anneal to the target template in the first round of PCR. Sometimes the PCR product is more specific with the attB primers, probably due to the longer annealing sequence (all of attB plus gene specific sequence) after the first round of amplification. Generally there is no need to change PCR reaction conditions when primers have the additional attB sequence

Answer Id: E3222

Was this answer helpful?


What is the influence of the attB sequence on protein function, solubility, folding, and expression?

Product FAQ


Destination vectors that contain N-terminal fusion partners will express proteins that contain amino acids contributed from the attB1 site, which is 25 bases long. This means that in addition to any tag (6x His and/or antibody epitope tag) the N-terminus of an expressed protein will contain an additional 9 amino acids from the AttB1 sequence - the typical amino acid sequence is Thr-Ser-Leu-Tyr-Lys-Lys-Ala-Gly-nnn, where nnn will depend on the codon sequence of the insert.

Effects on protein function: A researcher (Simpson et al. EMBO Reports 11(31):287-292, 2000) demonstrated that GFP fusions (N- terminal and C-terminal) localized to the proper intracellular compartment. The expression constructs were generated using Gateway® cloning, so the recombinant protein contained the attB1 or attB2 amino acid sequence. The localization function of the cloned recombinant proteins was preserved.

Effects on expression: We have seen no effect of the attB sites on expression levels in E. coli, insect and mammalian cells. The gus gene was cloned into bacterial expression vectors (for native and N-terminal fusion protein expression) using standard cloning techniques and expressed in bacteria. Gus was also cloned into Gateway® Destination vectors (for native and N-terminal fusion expression) and expressed. When protein expression is compared, there was no difference in the amount of protein produced. This demonstrates that for this particular case the attB sites do not interfere with transcription or translation.

Effects on solubility: A researcher at the NCI has shown that Maltose Binding Protein fusions constructed with Gateway® Cloning were soluble. The fusion proteins expressed had the attB amino acid sequence between the Maltose Binding Protein and the cloned protein. It is possible that some proteins containing the attB sequence could remain insoluble when expressed in E.coli.

Effects on folding: Two Hybrids screens show the same interacters identified with and without the attB sequence. Presumably correct protein folding would be required for protein-protein interactions to take place. It is possible that some proteins containing the attB sequence may not fold correctly.

Answer Id: E3223

Was this answer helpful?


How large can PCR fragments be and still be cloned into a Gateway® Entry vector?

Product FAQ


There is no size restriction on the PCR fragments if they are cloned into a pDONR vector. The upper limit for efficient cloning into a TOPO® adapted Gateway® Entry vector is approximately 5 kb. A Gateway® recombination reaction can occur between DNA fragments that are as large as 150 kb.

Answer Id: E3224

Was this answer helpful?


What do attL1 and attL2 sites look like after recombination between attB and attP sites?

Product FAQ


The attP1 sequence (pDONR™) is:

The region within brackets is where the site is "cut" and replaced by the attB1-fragment sequence to make an attL1 site. The sequence GTACAAA is the overlap sequence present in all att1 sites and is always "cut" right before the first G.

The overlap sequence in attP2 sites is CTTGTAC and cut before C. This is attP2:

So, attL1 (Entry Clone) should be:

attL2 (Entry Clone) should be:

The sequence in brackets comes from attB, and N is your gene-specific sequence.

Note: When creating an Entry Clone through the BP reaction and a PCR product, the vector backbone is not the same as Gateway® Entry vectors. The backbone in the case of PCR BP cloning is pDONR™201.

Answer Id: E3225

Was this answer helpful?


Do you have recommended sequencing primers for pDONR™201?

Product FAQ


We do not offer pre-made primers, but we can recommend the following sequences that can be orders as custom primers for sequencing of pDONR™201:
Forward primer, proximal to attL1: 5'- TCGCGTTAACGCTAGCATGGATCTC
Reverse primer, proximal to attL2: 5'-GTAACATCAGAGATTTTGAGACAC

Answer Id: E3236

Was this answer helpful?


Do I have to synthesize new attB primers (29 base attB primer + my specific sequence primer) each time I want to make an attB PCR product, or do you have truncated attB primers that work together with adapter attB primers to get a complete attB sequence?

Product FAQ


We do have an alternative method called the "attB Adapter PCR" Protocol in which you make your gene specific primer with only 12 additional attB bases and use attB universal adapter primers. This protocol allows for shorter primers to amplify attB-PCR products by utilizing four primers instead of the usual two in a PCR reaction. You can find the sequence of these primers in the protocol on page 45 of the "Gateway® Technology with Clonase II" manual.

There is a protocol in which all 4 primers mentioned above are in a single PCR reaction. You can find this protocol at in the following article: Quest vol. 1, Issue 2, 2004. The best ratio of the first gene-specific and the second attB primers was 1:10.

Answer Id: E3237

Was this answer helpful?


What primer purity should be used for adding attB sites to my PCR product?

Product FAQ


Standard desalted purity is generally sufficient for creating attB primers. We examined HPLC-purified oligos for Gateway® cloning (about 50bp long) and found only about a 2-fold increase in colony number over standard desalted primers. If too few colonies are obtained, you may try to increase the amount of PCR product used and/or incubate the BP reaction overnight.

Answer Id: E3172

Was this answer helpful?


What is the smallest fragment that can be used in a Gateway® reaction?

Product FAQ


The smallest size we have recombined is a 70 bp piece of DNA located between the att sites. Very small pieces are difficult to clone since they negatively influence the topology of the recombination reaction.

Answer Id: E3198

Was this answer helpful?


Can the attB primers anneal in a non-specific manner?

Product FAQ


No, attB primers are highly specific under standard PCR conditions. We have amplified from RNA (RT-PCR), cDNA libraries, genomic DNA, and plasmid templates without any specificity problems.

Answer Id: E3199

Was this answer helpful?


Will Gateway® att sites affect the expression of my protein?

Product FAQ


Expression experiments have shown that the extra amino acids contributed by the attB site to a fusion protein will most likely have no effect on protein expression levels or stability. In addition, they do not appear to have any effect on two-hybrid interactions in yeast. However, as is true with the addition of any extra sequences that result from tags, the possible effects will be protein-dependent.

Answer Id: E3200

Was this answer helpful?


Are the Gateway® attB1 and attB2 sites the same as the attB site used for recombination into E. coli by bacteriophage lambda?

Product FAQ


The Gateway® attB sites are derived from the bacteriophage lambda site-specific recombination, but are modified to remove stop codons and reduce secondary structure. The core regions have also been modified for specificity (i.e., attB1 will recombine with attP1 but not with attP2).

Answer Id: E3201

Was this answer helpful?


Where is the ATG relative to the 5' attB site in a Gateway® expression clone?

Product FAQ


This depends on whether you are expressing a fusion or a native protein in the Gateway® destination vector. For an N-terminal fusion protein the ATG will be given by the destination vector and it will be upstream of the attB1 site. For a C-terminal fusion protein or a native protein, the ATG should be provided by your gene of interest, and it will be downstream of the attB1 site.

Answer Id: E3202

Was this answer helpful?


How would you incorporate a leader sequence for secretion into an entry vector?

Product FAQ


A simple way to express a protein with a leader sequence is to have the leader sequence encoded in the destination vector. The other option is to have the leader sequence subcloned into the entry vector using restriction enzymes, or incorporate the leader sequence into the forward PCR primer when cloning a PCR product into the entry vector. Please see Esposito et al. (2005), Prot. Exp. & Purif. 40, 424-428 for an example of how a partial leader sequence for secretion was incorporated into an entry vector.

Answer Id: E3203

Was this answer helpful?


How clean must my DNA be to use in a Gateway® cloning reaction?

Product FAQ


Mini-prep (alkaline lysis) DNA preparations work well in Gateway® cloning reactions. It is important that the procedure remove contaminating RNA for accurate quantification. Plasmid DNA purified with our S.N.A.P.™ nucleic acid purification kits, ChargeSwitch® kits, or PureLink® kits are recommended.

Answer Id: E3204

Was this answer helpful?
