Introduction

Neural stem cells (NSC) are valuable resources because of their ability to differentiate into neurons and glial cells with applications in neuroscience and clinical use for treatment of neurodegenerative disease and neurological disorders. NSC are obtained by isolation from tissue, or differentiated from pluripotent cells. This page describes methods for expanding human NSC in cell culture and their subsequent characterization.

Required Materials

Cells

  • Human neural stem cells (e.g., Cat. no. N7800-100)

Reagents

  • StemPro® NSC SFM (Cat. no. A10509-01)
  • β-Mercaptoethanol (Cat. no. 21985)
  • GlutaMAX™-I (Cat. no. 35050)
  • CELLstart™ CTS™ (Cat. no. A10142-01)
  • Fibronectin (Cat No. 33016-015)
  • Water, distilled (Cat. no. 15230)
  • Dulbecco’s Phosphate-Buffered Saline (D-PBS) without Ca2+ and Mg2+ (Cat. no. 14190)
  • Dulbecco’s Phosphate-Buffered Saline (D-PBS) (Cat. no. 14040)
  • StemPro® Accutase® Cell Dissociation Reagent(Cat. no. A11105)
  • TrypLE™ Express Stable Trypsin Replacement Enzyme (Cat. no. 12604-013)
TOP

Ordering Information

Sku Name Size Price Qty
N7800100 Gibco® Human Neural Stem Cells (H9-Derived) 1 mL USD 698.00
A1050901 StemPro® NSC SFM 1 kit USD 224.00
21985023 2-Mercaptoethanol (55 mM) 50 mL USD 33.90
35050061 GlutaMAX™ Supplement 100 mL USD 30.40
A1014201 CTS™ CELLstart™ Substrate 2 mL USD 236.00
33016015 Fibronectin Human Protein, Plasma 5 mg USD 356.00
15230001 Distilled Water 6 x 1 L USD 107.00
14190136 DPBS, no calcium, no magnesium 1,000 mL USD 29.40
14040117 DPBS, calcium, magnesium 1,000 mL USD 29.40
A1110501 StemPro® Accutase® Cell Dissociation Reagent 100 mL USD 37.60
12604013 TrypLE™ Express Enzyme (1X), no phenol red 100 mL USD 21.90

Preparing Media

StemPro® NSC SFM Complete Medium

StemPro® NSC SFM complete medium consists of KnockOut™ D-MEM/F-12 with StemPro® Neural Supplement, bFGF, EGF, and GlutaMAX™-I. Complete medium is stable for 4 weeks when stored in the dark at 2-8°C.

To prepare 100 mL of complete medium:

  1. Reconstitute bFGF and EGF with 0.1% BSA solution (in KnockOut™ D-MEM/F-12) at a concentration of 100 μg/mL. You will need 20 μL of each per 100 mL of complete medium. Freeze unused portions in aliquots.

  2. Mix the following components under aseptic conditions. For larger volumes, increase the component amounts proportionally.


Component Final concentration Amount
KnockOut™ D-MEM/F-121X97 mL
GlutaMAX™-I Supplement2 mM2 mM
bFGF (prepared as 100 μg/mL stock)20 ng/mL20 ng/mL
EGF (prepared as 100 μg/mL stock)20 ng/mL20 μL
StemPro® Neural Supplement2%2 mL

You may observe a white precipitate when thawing StemPro® Neural Supplement; this precipitate will disappear when the supplement is completely thawed or dissolved.
TOP

Preparing Matrix

For culture of adherent cultures, use either Fibronectin or CELLstart™ CTS™ to prepare a matrix for coating your plates.

Coating Culture Vessels with CELLstart™ CTS™

  1. Dilute CELLstart™ CTS™ 1:100 in D-PBS with calcium and magnesium (i.e., 50 μL of CELLstart™ CTS™ into 5 mL of D-PBS). Note: CELLstart™ CTS™ should not be frozen, vortex or exposed to vigorous agitation due to potential gel formation.

  2. Coat the surface of the culture vessel with the working solution of CELLstart™ CTS™ (14 mL for T-75, 7 mL for T-25, 3.5 mL for 60-mm dish, 2 mL for 35-mm dish).

  3. Incubate the culture vessel at 37°C in a humidified atmosphere of 5% CO2 for 1 hour.

  4. Remove the vessel from the incubator and store it until use. Remove all CELLstart™ CTS™ solution immediately before use, and fill the vessel with complete StemPro® NSC SFM. Note: You may coat the plates in advance and store them at 4°C, wrapped tightly with Parafilm®, for up to 2 weeks. Do not remove CELLstart™ CTS™ solution until just prior to use. Make sure the plates do not dry out.

Coating Culture Vessels with Fibronectin

  1. Dilute Fibronectin in distilled water to make a 1-mg/mL stock solution.

  2. Store working solution at -20°C until use.

  3. Add stock solution to D-PBS to make a working solution of 20 μg/mL.

  4. Add enough working solution to cover the surface of the culture vessel (10 mL for T-75, 2.5 mL for 60-mm dish, 1.5 mL for 35-mm dish).

  5. Incubate the culture vessel at 37°C in a humidified atmosphere of 5% CO2   for 1 hour.

  6. Remove the vessel from the incubator and store it until use. Remove Fibronectin solution immediately before use, and fill the vessel with complete StemPro® NSC SFM.

Note: You may store the Fibronectin-treated plates at 4°C, wrapped tightly with Parafilm®, for up to 2 weeks. Ensure that plates do not dry out. There is no washing step needed and use the dish directly after aspiration.

TOP

Culturing Neural Stem Cells

Neural stem cell (NSCs) populations can be expanded from frozen stocks and grown in StemPro® NSC SFM complete medium as adherent cultures, or as suspension cultures. In either environment, change the spent culture medium every other day. When the cells in adherent culture reach >90% confluency, they are ready to be passaged. When the neurospheres in suspension culture become > 3.5 mm in diameter, they are ready to
be passaged. Cells cultured during expansion can be frozen down to create additional frozen stocks of higher passage number.

Thawing Frozen Neural Stem Cells

  1. Prepare 10 mL of 1X KnockOut™ D-MEM/F-12 and warm to 37°C.

  2. Transfer vial of frozen NSC from nitrogen tank to water bath. It is important to make the transfer immediately to prevent crystal formation.

  3. Transfer thawed cells into a 15-mL tube and add warmed 1X KnockOut™ D-MEM/F-12 to 10 mL.

  4. Spin down the thawed cells by centrifugation at 1,000 rpm for 4 minutes. Aspirate and discard the supernatant.

  5. Resuspend the cells in StemPro® NSC SFM complete medium and plate on a CELLstart™ CTS™ or Fibronectin-coated plate at high density (1 × 105 cells/cm2).

Note:
Viability of thawed cells should be ~80% if they were frozen following the cryopreservation protocol described here.

Passaging Neural Stem Cells (Adherent Culture)

  1. Aspirate the medium and wash with D-PBS without Ca2+ and Mg2+.

  2. Add 1 mL of TrypLE™ Express or StemPro® Accutase® to the culture vessel. Note: The monolayer lifts off from the culture dish within 30 seconds of application of TrypLE™ Express or StemPro® Accutase®.

  3. Gently pipette to loosen monolayer into a single cell suspension. Neutralize the treatment by adding 4 mL of medium. Do not treat the cells for longer than 3 minutes after addition of TrypLE™ Express or StemPro® Accutase®.

  4. Spin down the cells by centrifugation at 1,200 rpm for 4 minutes. Aspirate and discard the supernatant.

  5. Resuspend the cells in StemPro® NSC SFM complete medium.

  6. Count the cell number using a hemacytometer.

  7. Plate cells in fresh medium on a CELLstart™ CTS™- or Fibronectin-coated plate at a density of 1 × 104-1 × 105 cells/cm2, or split the cells at a 1:4 ratio.

Passaging Neural Stem Cells (Suspension Culture)

  1. Transfer medium containing neurospheres into a 15- or 50-mL conical tube.

  2. Leave the tube at room temperature and allow the neurosphere to settle to the bottom of tube. Alternatively, spin down the cells by centrifugation at 500 rpm (200 × g) for 2 minutes.

  3. Aspirate the supernatant carefully, and leave the neurospheres in a minimum volume of medium.

  4. Wash the neurospheres with 10 mL D-PBS without Ca2+ and Mg2+, aspirate the D-PBS supernatant carefully, and leave the neurospheres in a minimum volume of D-PBS.

  5. Add 1 mL of TrypLE™ Express to the spheres and gently triturate neurospheres using a Pasteur pipette to create a single cell suspension.

  6. Neutralize the treatment by adding 4 mL of medium.

  7. Spin down the cells by centrifugation at 1,200 rpm for 4 minutes. Aspirate and discard the supernatant.

  8. Resuspend the cells in StemPro® NSC SFM complete medium.

  9. Count cell number using hemacytometer.

  10. Seed the cells in fresh medium in a suspension dish (a non-coated flask can be used) at a density of 200,000 cells/mL.

Cryopreserving Neural Stem Cells

  1. Aspirate the medium and wash with D-PBS without Ca2+ and Mg2+.

  2. Add 1 mL of TrypLE™ Express to the culture vessel.

  3. Gently pipette to loosen monolayer into a single cell suspension. Neutralize the treatment by adding 4 mL of medium. Do not treat the cells for longer than 3 minutes after addition of TrypLE™ Express.

  4. Spin down the cells by centrifugation at 1,200 rpm for 4 minutes. Aspirate the supernatant.

  5. Resuspend the cells in StemPro® NSC SFM complete medium at a density of 2 × 106 cells/mL.

  6. Prepare freezing medium consisting of 20% DMSO and 80% medium. Note: Freezing medium (2X) can be prepared on the day of use and stored at 4°C until use.

  7. Add a volume of freezing medium equal to the amount of StemPro® NSC SFM complete medium used to resuspend the cells in a drop-wise manner.

  8. Prepare 1 mL aliquots (1 × 106 cells) in cryovials and place the vials in an isopropanol chamber.

  9. Put the isopropanol chamber at -80°C and transfer the vials to liquid nitrogen storage the next day.
TOP

Characterizing NSCs by Immunocytochemistry and PCR

Antibodies for NSC Characterization

Use the antibodies listed in the following table to characterize NSCs by immunocytochemistry.

Category Antigen Type Working concentration
Neural Stem CellsSox1Mouse IgG1:200
 Sox2Mouse IgG2 μg/mL
 CD133Rabbit IgG1:100
ProliferationKi67Rabbit IgG1:50
 EdUChemical1:1,000
Isotype ControlMouseIgM and IgGDo not dilute
 RabbitIgGDo not dilute
 RatIgM and IgG1:50

Primers for NSC Characterization

Use the primer sets listed in the following table to characterize NSC by PCR

Target Primer Sequence Tm Amplicon
size
Intron
size
Neural Stem CellsSox1-FGCGGAAAGCGTTTTCTTG53.0406
No Intron
 Sox1-RTGACTTCTCCTCCC50.2406No Intron

Sox2-FATGCACCGCTACGACGTGA59.3437
No Intron

Sox2-RCTTTTGCACCCCTCCCATTT56.0437No Intron

Nestin-FCAGCGTTGGAACAGAGGTTGG58.6389
1142

Nestin-R
TGGCACAGGTGTCTCAAGGGTAG
60.7
3891142
Endogenous
Control
ACTB-F
ACCATGGATGATGATATCGC
58.2
281
135

ACTB-R
TCATTGTAGAAGGTGTGGTG
54.4
281135
LT148                  17-Mar-2011