PCR Primers

Introduction

After cells are isolated from tissue or differentiated from pluripotent precursors, the resulting population needs to be characterized to confirm whether the target population has been obtained. The table below lists PCR primers that can be used in quantitative polymerase chain reactions (qPCR) to measure the expression levels of specific genes for characterizing neural stem cells (NSCs) and their sublineages.

View PCR primers by target

Target Primer         Sequence Tm
(°C)
Amplicon size (bp) Intron size (bp)
Neural stem cellsSOX1-F GCGGAAAGCGTTTTCTTG53.0406No Intron
 SOX1-R TAATCTGACTTCTCCTCCC50.2  
 SOX2-F   ATGCACCGCTACGACGTGA59.3437 No Intron
 SOX2-R CTTTTGCACCCCTCCCATTT56.0  
 NESTIN-FCAGCGTTGGAACAGAGGTTGG58.63891,142
 NESTIN-RTGGCACAGGTGTCTCAAGGGTAG60.7  
OligodendrocytesMAG-F    TCTGGATTATGATTTCAGCC49.7366159
 MAG-R   GCTCTGAGAAGGTGTACTGG54.7  
 OSP-F ACTGCTGCTGACTGTTCTTC55.12835,714
 OSP-R   GTAGAAACGGTTTTCACCAA50.8  
AstrocytesALDH1L1-FTCACAGAAGTCTAACCTGCC55.539821,837
 ALDH1L1-RAGTGACGGGTGATAGATGAT54.4  
 GFAP-F  GTACCAGGACCTGCTCAAT55.03212,989
 GFAP-R     CAACTATCCTGCTTCTGCTC55.3  
NeuronsMAP2-F CCACCTGAGATTAAGGATCA55.148211,798
 MAP-R GGCTTACTTTGCTTCTCTGA55.0  
 ChAT-FACTGGGTGTCTGAGTACTGG55.0 4517,692
 ChAT-R TTGGAAGCCATTTTGACTAT54.9  
Endogeneous controlACTB-F ACCATGGATGATGATATCGC58.2281135
 ACTB-R TCATTGTAGAAGGTGTGGTG54.4  
GABAergic/Glutaminergic neurons GAD1-FGTCGAGGACTCTGGACAGTA 55.335712,277
 GAD1-RGGAAGCAGATCTCTAGCAAA54.9   
Serotonergic neuronsSLC6A4-FGCCTTTTACATTGCTTCCTA54.84472,251
 SLC6A4-RCCAATTGGGTTTCAAGTAGA55.2  
Cholinergic neuronsChAT-F ACTGGGTGTCTGAGTACTGG55.04517,692
 ChAT-R TTGGAAGCCATTTTGACTAT54.9   
Dopaminergic neuronsTH-F TCATCACCTGGTCACCAAGTT56.0126656
  GGTCGCCGTGCCTGTACT60.0  

 TOP

                  09-May-2012