Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AATCCTTGCTCTGCGATGGACTATT[C/T]CCTGGCTGCAGCCCTCACTCTTCAT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 602690 MIM: 606659 | ||||||||||||||||||||
Literature Links: |
C11orf57 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
C11orf57 - chromosome 11 open reading frame 57 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SDHD - succinate dehydrogenase complex subunit D | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001276503.1 | Intron | NP_001263432.1 | ||||
NM_001276504.1 | Intron | NP_001263433.1 | ||||
NM_001276506.1 | Intron | NP_001263435.1 | ||||
NM_003002.3 | Intron | NP_002993.1 |
TIMM8B - translocase of inner mitochondrial membrane 8 homolog B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |