Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGGGTGGATCACAGAGGATGGGATG[C/G]TGATGGGATGGCGGTGTCACATACT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 606687 MIM: 605963 MIM: 613598 | ||||||||||||||||||||
Literature Links: |
EIF2B4 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
EIF2B4 - eukaryotic translation initiation factor 2B subunit delta | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001034116.1 | Intron | NP_001029288.1 | ||||
NM_001318965.1 | Intron | NP_001305894.1 | ||||
NM_001318966.1 | Intron | NP_001305895.1 | ||||
NM_001318967.1 | Intron | NP_001305896.1 | ||||
NM_001318968.1 | Intron | NP_001305897.1 | ||||
NM_001318969.1 | Intron | NP_001305898.1 | ||||
NM_015636.3 | Intron | NP_056451.3 | ||||
NM_172195.3 | Intron | NP_751945.2 |
LOC105374363 - uncharacterized LOC105374363 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNX17 - sorting nexin 17 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ZNF513 - zinc finger protein 513 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |