Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ATCACAATTGTAGCAAAAACTTGCC[A/C]AACTAGAAGAGGCGAAGCAGGCTTC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
1 submissions
|
||||||||||||||||||||
Phenotype: |
MIM: 603270 MIM: 611734 | ||||||||||||||||||||
Literature Links: |
ATP5F1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ATP5F1 - ATP synthase, H+ transporting, mitochondrial Fo complex subunit B1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001688.4 | 821 | Missense Mutation | AAA,CAA | K,Q 134 | NP_001679.2 |
C1orf162 - chromosome 1 open reading frame 162 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
WDR77 - WD repeat domain 77 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |